ID: 1056078142_1056078151

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1056078142 1056078151
Species Human (GRCh38) Human (GRCh38)
Location 9:83062522-83062544 9:83062574-83062596
Sequence CCAGCGCCGCCGCCGCGTCCTCG CTCCGGCCCCGCCTCAGACACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 21, 3: 169, 4: 1141} {0: 1, 1: 0, 2: 0, 3: 16, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!