ID: 1056128937_1056128943

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1056128937 1056128943
Species Human (GRCh38) Human (GRCh38)
Location 9:83565141-83565163 9:83565187-83565209
Sequence CCAGTTGCCTCCCTTACTTCATT CACTGATGCTATTTTTGATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 397} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!