ID: 1056132004_1056132009

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1056132004 1056132009
Species Human (GRCh38) Human (GRCh38)
Location 9:83596475-83596497 9:83596489-83596511
Sequence CCAACTATATGCCAAATCATCCT AATCATCCTGGTAAGGTATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 179} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!