ID: 1056214847_1056214855

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1056214847 1056214855
Species Human (GRCh38) Human (GRCh38)
Location 9:84397457-84397479 9:84397503-84397525
Sequence CCATCTAAGAGCTGCTTAGCAGG GCCGGATCAGAGGCAGAAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!