ID: 1056271836_1056271842

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1056271836 1056271842
Species Human (GRCh38) Human (GRCh38)
Location 9:84954745-84954767 9:84954772-84954794
Sequence CCAGCTCTGGTGCTGGTGGGGAC TGGAGGAATCAGCTTGGTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!