ID: 1056273950_1056273952

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1056273950 1056273952
Species Human (GRCh38) Human (GRCh38)
Location 9:84974803-84974825 9:84974817-84974839
Sequence CCCTGCTGGCTTCAGCTTTCCCT GCTTTCCCTAAGCAGCCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 579} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!