ID: 1056278901_1056278910

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1056278901 1056278910
Species Human (GRCh38) Human (GRCh38)
Location 9:85020418-85020440 9:85020462-85020484
Sequence CCATTGGCTGGGGCCTTGTTTTG CACGATCTTATGGGCTTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 188} {0: 1, 1: 0, 2: 0, 3: 4, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!