ID: 1056395102_1056395107

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1056395102 1056395107
Species Human (GRCh38) Human (GRCh38)
Location 9:86174744-86174766 9:86174790-86174812
Sequence CCCACCTCATTTGTCTTGTTCAT TTGTGTTAGAATTCGTCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 314} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!