ID: 1056405053_1056405058

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1056405053 1056405058
Species Human (GRCh38) Human (GRCh38)
Location 9:86265637-86265659 9:86265676-86265698
Sequence CCACCATATTACTACCAGCAGTC GATTTTAGGAGTCACCGATCTGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 1, 3: 7, 4: 75} {0: 1, 1: 1, 2: 2, 3: 4, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!