ID: 1056458944_1056458950

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1056458944 1056458950
Species Human (GRCh38) Human (GRCh38)
Location 9:86790895-86790917 9:86790945-86790967
Sequence CCGAGCTGAATCCAATTCAGTAC ATTTGAGCTAGGGTTTATGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!