ID: 1056499063_1056499067

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1056499063 1056499067
Species Human (GRCh38) Human (GRCh38)
Location 9:87190166-87190188 9:87190203-87190225
Sequence CCTAAAATATGTTCCTGTGTCCA CACCTGTAATCCCAGCACTTTGG
Strand - +
Off-target summary No data {0: 68945, 1: 203244, 2: 249087, 3: 204446, 4: 175427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!