ID: 1056514828_1056514832

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1056514828 1056514832
Species Human (GRCh38) Human (GRCh38)
Location 9:87340296-87340318 9:87340318-87340340
Sequence CCATCACCTGGGGTATCAAAAAG GAGAAAGGAAAAAAGCAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 93} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!