ID: 1056555798_1056555806

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1056555798 1056555806
Species Human (GRCh38) Human (GRCh38)
Location 9:87686254-87686276 9:87686301-87686323
Sequence CCTAAGCAGAAATCACATGGCAA GGACCAGCCACCCGGGCAACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 38, 4: 313} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!