ID: 1056555799_1056555809

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1056555799 1056555809
Species Human (GRCh38) Human (GRCh38)
Location 9:87686278-87686300 9:87686305-87686327
Sequence CCAGCCTAGAGACACAATCCCTA CAGCCACCCGGGCAACAGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!