ID: 1056574180_1056574187

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1056574180 1056574187
Species Human (GRCh38) Human (GRCh38)
Location 9:87842726-87842748 9:87842747-87842769
Sequence CCAACCGGCCCCTTCTTTGCTGT GTGGACTAAACAGGAACCACTGG
Strand - +
Off-target summary No data {0: 7, 1: 1, 2: 0, 3: 6, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!