ID: 1056584968_1056584973

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1056584968 1056584973
Species Human (GRCh38) Human (GRCh38)
Location 9:87921832-87921854 9:87921865-87921887
Sequence CCTTCCTTGAGCTGTGTACTCAG AAGCCCATATTGTGAGGTTTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 23, 4: 215} {0: 1, 1: 7, 2: 1, 3: 14, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!