ID: 1056586784_1056586791

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1056586784 1056586791
Species Human (GRCh38) Human (GRCh38)
Location 9:87932432-87932454 9:87932462-87932484
Sequence CCAGGTCCCCACTGACTAGGCTT CTAGGTCACCAGGTCCCCATTGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 0, 3: 48, 4: 190} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!