ID: 1056591541_1056591548

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1056591541 1056591548
Species Human (GRCh38) Human (GRCh38)
Location 9:87969241-87969263 9:87969275-87969297
Sequence CCAGCAGATCCAATGCCTGGGGA CAGCACCTCCTCCAGGGGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 112, 4: 637} {0: 1, 1: 1, 2: 2, 3: 49, 4: 501}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!