ID: 1056606850_1056606856

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1056606850 1056606856
Species Human (GRCh38) Human (GRCh38)
Location 9:88093036-88093058 9:88093057-88093079
Sequence CCCCTTAAAAACCTTTGCCCAGA GAACCCCTCAATGAAATGAGAGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 23, 3: 48, 4: 254} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!