ID: 1056610081_1056610090

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1056610081 1056610090
Species Human (GRCh38) Human (GRCh38)
Location 9:88120459-88120481 9:88120501-88120523
Sequence CCTCCTCAGTGAAGGCCTCACCA GTCATTGGAAGCCTAGTCAGTGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 13, 3: 27, 4: 235} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!