ID: 1056611839_1056611848

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1056611839 1056611848
Species Human (GRCh38) Human (GRCh38)
Location 9:88130733-88130755 9:88130770-88130792
Sequence CCACCTGCCCTCCTGTCCAGCTG GACCCATGATCATTCGAAGATGG
Strand - +
Off-target summary {0: 9, 1: 0, 2: 12, 3: 110, 4: 776} {0: 1, 1: 3, 2: 2, 3: 3, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!