ID: 1056611839_1056611853

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1056611839 1056611853
Species Human (GRCh38) Human (GRCh38)
Location 9:88130733-88130755 9:88130783-88130805
Sequence CCACCTGCCCTCCTGTCCAGCTG TCGAAGATGGGATCCCTCGCGGG
Strand - +
Off-target summary {0: 9, 1: 0, 2: 12, 3: 110, 4: 776} {0: 1, 1: 1, 2: 0, 3: 4, 4: 19}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!