ID: 1056619165_1056619168

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1056619165 1056619168
Species Human (GRCh38) Human (GRCh38)
Location 9:88196145-88196167 9:88196185-88196207
Sequence CCAGGCAGTGGTTTCACATGGCT GAAATAGCTGCAGAAACTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 248} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!