ID: 1056691995_1056691999

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1056691995 1056691999
Species Human (GRCh38) Human (GRCh38)
Location 9:88815715-88815737 9:88815759-88815781
Sequence CCCCAGAAGCGGAGTGTCTGCTC AGGTTGTGCACCAAAGCAGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!