ID: 1056747734_1056747739

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1056747734 1056747739
Species Human (GRCh38) Human (GRCh38)
Location 9:89318742-89318764 9:89318767-89318789
Sequence CCTACCGGGTGGCCGCGATCTTC GCCCCGCCTCGGGTCCGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 24} {0: 1, 1: 0, 2: 3, 3: 23, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!