ID: 1056757556_1056757560

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1056757556 1056757560
Species Human (GRCh38) Human (GRCh38)
Location 9:89391472-89391494 9:89391487-89391509
Sequence CCATGAGGTCACGAGGCCGGCCA GCCGGCCAACACTACCTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 53} {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!