ID: 1056764494_1056764498

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1056764494 1056764498
Species Human (GRCh38) Human (GRCh38)
Location 9:89436515-89436537 9:89436530-89436552
Sequence CCAGCCACAACAAGGCACCCTTC CACCCTTCAGCGCAGGGACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132} {0: 1, 1: 0, 2: 0, 3: 14, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!