ID: 1056805548_1056805557

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1056805548 1056805557
Species Human (GRCh38) Human (GRCh38)
Location 9:89726129-89726151 9:89726173-89726195
Sequence CCAAACACCCCCAGGGGTTATGC GCCTTTCCACTGCCAGGCAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!