ID: 1056811479_1056811483

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1056811479 1056811483
Species Human (GRCh38) Human (GRCh38)
Location 9:89768425-89768447 9:89768454-89768476
Sequence CCTGAAGACAAAGTACAGTTAAA GCTATTGAGAAGTGGAGAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 30, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!