ID: 1056832983_1056832993

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1056832983 1056832993
Species Human (GRCh38) Human (GRCh38)
Location 9:89931533-89931555 9:89931585-89931607
Sequence CCTGCACGACCCTCCTCCGAGGA TCAAATTTTGCCTACGTGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!