ID: 1056886561_1056886565

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1056886561 1056886565
Species Human (GRCh38) Human (GRCh38)
Location 9:90448936-90448958 9:90448962-90448984
Sequence CCTCTGCTTTGGTGGTGTTTCTG CTTGTTGCCCAACTGGAGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!