ID: 1056941680_1056941686

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1056941680 1056941686
Species Human (GRCh38) Human (GRCh38)
Location 9:90961580-90961602 9:90961593-90961615
Sequence CCCAAGCACCCGCTTTGCAGGTT TTTGCAGGTTCTGGGCATGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 32, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!