ID: 1056985994_1056986002

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1056985994 1056986002
Species Human (GRCh38) Human (GRCh38)
Location 9:91364185-91364207 9:91364222-91364244
Sequence CCCCTTCTGAGTTGGGGTGGGAA CTGCAGCACAGCTGCAGACTGGG
Strand - +
Off-target summary {0: 2, 1: 8, 2: 28, 3: 71, 4: 248} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!