ID: 1057030270_1057030275

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1057030270 1057030275
Species Human (GRCh38) Human (GRCh38)
Location 9:91769763-91769785 9:91769777-91769799
Sequence CCCTCCAGTACCTTCATGATCTG CATGATCTGAGGTCCTCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 205} {0: 1, 1: 0, 2: 11, 3: 444, 4: 1000}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!