ID: 1057035986_1057035997

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1057035986 1057035997
Species Human (GRCh38) Human (GRCh38)
Location 9:91811889-91811911 9:91811933-91811955
Sequence CCAGGGGAGCTCCCCACACACTC CTCTGGTTTGGTCTTAGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 244} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!