ID: 1057055813_1057055819

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1057055813 1057055819
Species Human (GRCh38) Human (GRCh38)
Location 9:91959858-91959880 9:91959878-91959900
Sequence CCGTGCCCAGCCTGCTTCTCTCT TCTGTTCTTAATAGGATTTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 30, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!