ID: 1057070910_1057070914

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1057070910 1057070914
Species Human (GRCh38) Human (GRCh38)
Location 9:92099232-92099254 9:92099246-92099268
Sequence CCCAAGGTCTGCACCAGGCTGCT CAGGCTGCTGCACTTGCTGGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 13, 4: 172} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!