ID: 1057076629_1057076641

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1057076629 1057076641
Species Human (GRCh38) Human (GRCh38)
Location 9:92141515-92141537 9:92141545-92141567
Sequence CCAGCCCGGCCCGGGGCCTACCG GGCCCCCTGCCACTGCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 27, 4: 257} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!