ID: 1057083775_1057083778

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1057083775 1057083778
Species Human (GRCh38) Human (GRCh38)
Location 9:92190437-92190459 9:92190450-92190472
Sequence CCCATAGGCAGCTGTCCATCTAC GTCCATCTACAGTGTCTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 102} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!