ID: 1057128563_1057128578

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1057128563 1057128578
Species Human (GRCh38) Human (GRCh38)
Location 9:92637967-92637989 9:92638007-92638029
Sequence CCCCACCGCCTACCTGGGGAAGG AGCGAAGGCTCCTACTGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 227} {0: 1, 1: 0, 2: 1, 3: 4, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!