ID: 1057133423_1057133431

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1057133423 1057133431
Species Human (GRCh38) Human (GRCh38)
Location 9:92670144-92670166 9:92670164-92670186
Sequence CCGCCGGAAGCCACGCCCCCGGC GGCGCCTGCCATGACGGAGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 243} {0: 1, 1: 0, 2: 1, 3: 4, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!