ID: 1057139716_1057139721

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1057139716 1057139721
Species Human (GRCh38) Human (GRCh38)
Location 9:92719042-92719064 9:92719066-92719088
Sequence CCAGCTCCTCACTGAAGGTCACC GCTCATCCTGGGCCACACTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 192} {0: 2, 1: 0, 2: 2, 3: 23, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!