ID: 1057162141_1057162149

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1057162141 1057162149
Species Human (GRCh38) Human (GRCh38)
Location 9:92896316-92896338 9:92896338-92896360
Sequence CCCTCCAGGGTGCCCTGACTCAC CCTTCCCTACAGATGGAGGCAGG
Strand - +
Off-target summary {0: 6, 1: 15, 2: 13, 3: 20, 4: 269} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!