ID: 1057171157_1057171158

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1057171157 1057171158
Species Human (GRCh38) Human (GRCh38)
Location 9:92963983-92964005 9:92964014-92964036
Sequence CCTGAAGATCTACACAGCAGATC AAAGTCCACCCAGCAGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 120} {0: 1, 1: 0, 2: 2, 3: 15, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!