ID: 1057182213_1057182217

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1057182213 1057182217
Species Human (GRCh38) Human (GRCh38)
Location 9:93036340-93036362 9:93036364-93036386
Sequence CCACACACCACCTGGAAAGCAGT CTGCATCTGTTGTCCTGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 231} {0: 1, 1: 0, 2: 0, 3: 25, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!