ID: 1057206678_1057206690

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1057206678 1057206690
Species Human (GRCh38) Human (GRCh38)
Location 9:93177766-93177788 9:93177806-93177828
Sequence CCCTCTGCACTCCAGACCCCCAT AGATGTCCCTAGCAGCAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 387} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!