ID: 1057208009_1057208017

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1057208009 1057208017
Species Human (GRCh38) Human (GRCh38)
Location 9:93184770-93184792 9:93184785-93184807
Sequence CCCCCTTTCCCAGGGCCCCCAGA CCCCCAGAGACGGCCCCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 524} {0: 1, 1: 0, 2: 1, 3: 12, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!