ID: 1057208010_1057208017

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1057208010 1057208017
Species Human (GRCh38) Human (GRCh38)
Location 9:93184771-93184793 9:93184785-93184807
Sequence CCCCTTTCCCAGGGCCCCCAGAG CCCCCAGAGACGGCCCCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 487} {0: 1, 1: 0, 2: 1, 3: 12, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!