ID: 1057220114_1057220121

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1057220114 1057220121
Species Human (GRCh38) Human (GRCh38)
Location 9:93253008-93253030 9:93253034-93253056
Sequence CCCCCTGTGAGCGAGGGGCCCGT GCCGCAGAGCCTGCCCTCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 72} {0: 1, 1: 0, 2: 0, 3: 20, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!