ID: 1057223148_1057223159

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1057223148 1057223159
Species Human (GRCh38) Human (GRCh38)
Location 9:93268507-93268529 9:93268553-93268575
Sequence CCCATAGGTGTAAAGGAGTTCAC GCAGGTGATGGGGGTCACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64} {0: 1, 1: 0, 2: 2, 3: 30, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!